View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_19 (Length: 204)
Name: NF11749_low_19
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 46053247 - 46053420
Alignment:
| Q |
18 |
acatacttccagaagtagaaatgatcaagttgttactgatttacgactctggtgtcgcgatgctattgataagatcttagcaagcataaaacaacttcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46053247 |
acatacttccagaagtagaaatgatcaagttgttactgatttacgactctggtgtcgtgatgctattgataagatcttagcaagtataaaacaacttcaa |
46053346 |
T |
|
| Q |
118 |
gtttcgcttcttaagctggctttgaacaatcagggtcttattgttcccggttatactcatttgcaacgtgcgca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46053347 |
gtttcgcttcttaagctggctttgaacaatcagggtcttattgttcccggttatactcatttgcagcgtgcgca |
46053420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University