View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_2 (Length: 506)
Name: NF11749_low_2
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 9 - 298
Target Start/End: Complemental strand, 17196703 - 17196414
Alignment:
| Q |
9 |
agcacagagcgtgagaaatggagacaccaccctcaaccggcgccgtgaagaagaaggagacaagaggacgcaaacctaaacccaaggaagacaagagaga |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196703 |
agcacagagagtgagaaatggagacaccaccctcaaccggcgccgtgaagaagaaggagacaagaggacgcaaacctaaacccaaggaagacaagagaga |
17196604 |
T |
 |
| Q |
109 |
agaaccatcacaagtgaagacaccgagagaatcgaagaaggaaaagcaacagcaacagcttcatcagcagcagcaacaacaagcttctgttgatgagaag |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196603 |
agaaccatcacaagtgaagtcaccgagagaatcgaagaaggaaaagcaacagcaacagcttcatcagcagcagcaacaacaagcttctgttgatgagaag |
17196504 |
T |
 |
| Q |
209 |
tactctcaatggaaatctcttgttcctgttctttatgattggctcgctaatcataacctcgtttggccttctctctcttgccggttaggg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196503 |
tactctcaatggaaatctcttgttcctgttctttatgattggcttgctaatcataacctcgtttggccttctctctcttgccggttaggg |
17196414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University