View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_7 (Length: 340)
Name: NF11749_low_7
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 20 - 328
Target Start/End: Complemental strand, 29191297 - 29190989
Alignment:
| Q |
20 |
aaccctactttcttagagtgatctggggtcattgacgtcatatttgtagcttcactgaaaactctgctgaaacaaaaccctaattagtttggtattgtga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191297 |
aaccctactttcttagagtgatctggggtcattgacgtcatatttgtagcttcactgaaaactctgctgaaacaaaaccctaattagtttggtattgtga |
29191198 |
T |
|
| Q |
120 |
agaaggaaaaagaagagggaaagagaaagttgagatgaaaggttacttgatcggagaatctgagaaagggtggtggaaaagagatttttatgattttggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191197 |
agaaggaaaaagaagagggaaagagaaagttgagatgaaaggttacttgatcggagaatctgagaaagggtggtggaaaagagatttttatgattttggt |
29191098 |
T |
|
| Q |
220 |
gttgaaannnnnnngattctgaaagcgaatttgaaaatgagaagaggatgttgggttgctttatcaacggctacttgtgttgagctcgatagacgttata |
319 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29191097 |
gttgaaatttttttgattctgaaagcgaatttgaaaatgagaagaggatgttgggttgctttatcaacggctacttgtgttcagctcgatagacgttata |
29190998 |
T |
|
| Q |
320 |
cgctcttca |
328 |
Q |
| |
|
||||||||| |
|
|
| T |
29190997 |
cgctcttca |
29190989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University