View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11749_low_8 (Length: 319)
Name: NF11749_low_8
Description: NF11749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11749_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 46053247 - 46053527
Alignment:
| Q |
18 |
acatacttccagaagtagaaatgatcaagttgttactgatttacgactctggtgtcgcgatgctattgataagatcttagcaagcataaaacaacttcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46053247 |
acatacttccagaagtagaaatgatcaagttgttactgatttacgactctggtgtcgtgatgctattgataagatcttagcaagtataaaacaacttcaa |
46053346 |
T |
 |
| Q |
118 |
gtttcgcttcttaagctggctttgaacaatcagggtcttattgttcccggttatactcatttgcagcgtgcgcagcctgttttattacagcaccttctgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46053347 |
gtttcgcttcttaagctggctttgaacaatcagggtcttattgttcccggttatactcatttgcagcgtgcgcaacctgttttattacagcaccttctgc |
46053446 |
T |
 |
| Q |
218 |
ttgcttatgttgaagaggtttgctttaaaatttaatttatgattctcttgcaaagtttgaattgttttaatggaaattatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||| |
|
|
| T |
46053447 |
ttgcttatgttgaagaggtttgctttaaaatttaatttatgattctcttgcaaagtttgagttgtgttaatggaaagtatg |
46053527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University