View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1174_high_15 (Length: 236)
Name: NF1174_high_15
Description: NF1174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1174_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 41980637 - 41980861
Alignment:
| Q |
1 |
tttggtgaattggaagaggaagcaagaaagaaagcatgggaagaaatgaactttatatgattgctatatatattgttcacattggttgtaattgatgatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41980637 |
tttggtgaattggaagaggaagcaagaaagaaagcatgggaagaaatgaactttatatgattgctatatat--tgttcacattggttgtaattgatgatt |
41980734 |
T |
 |
| Q |
101 |
tcctccggtttcatttcttcttataagnnnnnnnagcgactttttagtaagttattatgaatgggaattgggagcaattggattctgtagaattttggga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980735 |
tcctccggtttcatttcttcttataagtttttttagcgactttttagtaagttattatgaatgggaattgggagcaattggattctgtagaattttggga |
41980834 |
T |
 |
| Q |
201 |
tattgtcctacatatcatgatattatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41980835 |
tattgtcctacatatcatgatattatt |
41980861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University