View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1174_high_6 (Length: 341)
Name: NF1174_high_6
Description: NF1174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1174_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 47 - 284
Target Start/End: Complemental strand, 45410262 - 45410025
Alignment:
| Q |
47 |
tattaattaatatcacttttcagctatgcttcttcaaagtccttctttgtttggttggttacctaaatatcattcacaattgtttgnnnnnnnnnnnnnc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45410262 |
tattaattaatatcacttttcagctatgcttcttcaaagtccttctttgtttggttggttacctaaatatcattcacaattgtttgaaaaacaaaaaaac |
45410163 |
T |
|
| Q |
147 |
ataatgagtaatgaccagtagcataactatattgaactgaaattaagaatccaagtnnnnnnntgtcaagtaacaaagttccaaagacactggaacctta |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410162 |
ataatgagtaatgaccagtagcataaccatattgaactgaaattaagaatccaagtaaaaaaatgtcaagtaacaaagttccaaagacactggaacctta |
45410063 |
T |
|
| Q |
247 |
aattaaggttacctaacataatacaatgaagcaacgac |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410062 |
aattaaggttacctaacataatacaatgaagcaacgac |
45410025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University