View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1174_low_14 (Length: 306)
Name: NF1174_low_14
Description: NF1174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1174_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 174 - 293
Target Start/End: Original strand, 18185307 - 18185421
Alignment:
| Q |
174 |
gagattgcgtattagcgtgtttgcattgcgcacgtacatatgacttggaattggataataacatggtaagttataatccctttgttagtaattaccttat |
273 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185307 |
gagattgcgtaggagcgtgtttgcattgcgcac----atatgacttggaattggataataacatcgtaagttataatccctttgttagtaattaccttat |
18185402 |
T |
 |
| Q |
274 |
gggggagttttggaaggtct |
293 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18185403 |
-ggggagttttggaaggtct |
18185421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 18185272 - 18185309
Alignment:
| Q |
30 |
cctatgagggaaagaaatttttttgcaacccctatgag |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185272 |
cctatgagggaaagaaatttttttgcaacccctatgag |
18185309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University