View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1174_low_24 (Length: 251)
Name: NF1174_low_24
Description: NF1174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1174_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 31 - 241
Target Start/End: Original strand, 3373802 - 3374011
Alignment:
| Q |
31 |
ttacaaccgtaaaaaagtaagtatataaacttattttacctaagatgtaagaagaaaatttagtgacacgttacattttcttgtccaaaaatttttagtt |
130 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3373802 |
ttacaaccgtaaaa-agtaagtatataagcttattttacctaagatgtaagaagaaaatttagtgacacgttacattttcttgtccaaaaatttatagtt |
3373900 |
T |
 |
| Q |
131 |
ttgggatttacagaatcttttaattaaaaaataataacgcttaaagatcatacatggtgacactttgaagccatgtgtccgcaggagctcaaatgccagg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3373901 |
ttgggatttacagaatcttttaattaaaaaataataacgcttaaagatcatacatggtgacactttgaagccatgtgtccgcaggagctcaaatgccaga |
3374000 |
T |
 |
| Q |
231 |
ctatctctctg |
241 |
Q |
| |
|
|||||| |||| |
|
|
| T |
3374001 |
ctatctttctg |
3374011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 241
Target Start/End: Original strand, 3347534 - 3347601
Alignment:
| Q |
174 |
aagatcatacatggtgacactttgaagccatgtgtccgcaggagctcaaatgccaggctatctctctg |
241 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
3347534 |
aagatcatacatggtgatactttaaatccatgtgtcctaaggagctcaaatgccagactatctttctg |
3347601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University