View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1174_low_30 (Length: 236)

Name: NF1174_low_30
Description: NF1174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1174_low_30
NF1174_low_30
[»] chr4 (1 HSPs)
chr4 (1-224)||(41980637-41980858)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 41980637 - 41980858
Alignment:
1 tttggtgaattggaagaggaagcaagaaagaaagcatgggaagaaatgaactttatatgattgctatatatattgttcacattggttgtaattgatgatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
41980637 tttggtgaattggaagaggaagcaagaaagaaagcatgggaagaaatgaactttatatgattgctatatat--tgttcacattggttgtaattgatgatt 41980734  T
101 tcctccggtttcatttcttcttataagnnnnnnnagcgactttttagtaagttattatgaatgggaattgggagcaattggattctgtagaattttggga 200  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41980735 tcctccggtttcatttcttcttataagtttttttagcgactttttagtaagttattatgaatgggaattgggagcaattggattctgtagaattttggga 41980834  T
201 tattgtcctacatatcatgatatt 224  Q
    ||||||||||||||||||||||||    
41980835 tattgtcctacatatcatgatatt 41980858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University