View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11750_high_27 (Length: 322)
Name: NF11750_high_27
Description: NF11750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11750_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 309
Target Start/End: Complemental strand, 14192313 - 14192022
Alignment:
| Q |
19 |
cgtttctcccctgggtaagaaccctataaagatagactttggcgtgtaagcgtccttttttaggtctcgaagnnnnnnnggaaccctgcaaatgctgcat |
118 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14192313 |
cgtttctcccctgggtaagagtcctataaagatagactttggcgtgtaagcgtcctcttttaggtctcgaagtttgtttggaaccctgcaaatgctgcat |
14192214 |
T |
 |
| Q |
119 |
ggatgaacttcttcgtaaagtctagactccaacgctgcttgcctgttagggatgactgccatctttcaaacaaagaaaaaa-tatgtggtgagttagaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||| |||||| | ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14192213 |
ggatgaacttcttcgtaaagtctagactccaacactgcttgcatgtaagggataattgccatctttcaaacaaagaaaaaaatatgtggtgagttagaat |
14192114 |
T |
 |
| Q |
218 |
ttagaattagaagagaaagggtgtgcaataaacagaacaaatttcgtttatcttcccactctgcattctctaactatcataccgcgtctgtg |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14192113 |
ttagaattagaacagaaagggtgtgcaataaacagaacaaatttcgtttatcttcccactctgcattctctaactatcataccgcgtctgtg |
14192022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University