View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11750_high_32 (Length: 268)
Name: NF11750_high_32
Description: NF11750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11750_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 31 - 207
Target Start/End: Original strand, 21733160 - 21733338
Alignment:
| Q |
31 |
cgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattattc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21733160 |
cgagtttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattattc |
21733259 |
T |
 |
| Q |
131 |
ttcttc--ttttttggtacataaaacatacattttaatgcaagtcttaatatattttgatgtaaatcatggagcatttt |
207 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21733260 |
ttcttcttttttttcatacataaaacatacattttaatgcaagtcttaatatattttgatgtaaatcatggatcatttt |
21733338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 31 - 129
Target Start/End: Original strand, 21741661 - 21741759
Alignment:
| Q |
31 |
cgagtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattatt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21741661 |
cgagtttataatgaagctttctcttttgatccttttctttttgtctctcctcattagctcttctagcagtgagtttcttctcttctattgcatattatt |
21741759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 41 - 121
Target Start/End: Original strand, 21748683 - 21748763
Alignment:
| Q |
41 |
atgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgc |
121 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||| ||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
21748683 |
atgaagctatctcttttgatcattttctttgtgtctctcctggttagctcatcgtgcagtgagtatcttctcttctattgc |
21748763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 101
Target Start/End: Complemental strand, 30148120 - 30148053
Alignment:
| Q |
34 |
gtttataatgaagctttctcttttgatcattttctttttgtctctcctaattagctcttctagcagtg |
101 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | |||||| |||||||||||| || ||||||| |
|
|
| T |
30148120 |
gtttataatgaagctttctattttgatcattttctctgtgtctcccctaattagctcatcaagcagtg |
30148053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University