View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11750_high_33 (Length: 250)
Name: NF11750_high_33
Description: NF11750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11750_high_33 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 5414603 - 5414848
Alignment:
| Q |
5 |
catcaatgacttgggataagaaggaacaaaaacctttgcatcactttgtagtataaacttattcacatctgcatctgttgaaacaatggtagggcttcca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414603 |
catcaatgacttgggataagaaggaacaaaaacctttgcatcactttgtagtataaacttattcacatctgcatctgttgaaacaatggtagggcttcca |
5414702 |
T |
 |
| Q |
105 |
aatatgtgtgacttgaacactttaccatacctacaacaatttgcaacagcacaccaaaaatccttgtcaaaaacaaacaatctcgcgtggcttttcttat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414703 |
aatatgtgtgacttgaacactttaccatacctgcaacaatttgcaacagcacaccacaaatccttgtcaaaaacaaacaatctcgcgtggcttttcttat |
5414802 |
T |
 |
| Q |
205 |
ttttcattaaagtgacactaacgaccattttactggcaaacacact |
250 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5414803 |
ttttaattaaagtgacactaacgaccattttactgacaaacacact |
5414848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University