View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11750_high_34 (Length: 243)
Name: NF11750_high_34
Description: NF11750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11750_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 12142899 - 12142792
Alignment:
| Q |
1 |
aaaacaattcttttatgacaaacttttaagtaacaacattaaatatgtttttctattttatcaatcacaattatttttctcataatttcttatgtatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12142899 |
aaaacaattcttttatgacaaacttttaagtaacaacattaaatatgtttttctattttatcaatcacaattatttttctcataatttcttatgtatcaa |
12142800 |
T |
|
| Q |
101 |
tgacaaaa |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
12142799 |
tgacaaaa |
12142792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 107
Target Start/End: Complemental strand, 29005373 - 29005323
Alignment:
| Q |
57 |
tttatcaatcacaattatttttctcataatttcttatgtatcaatgacaaa |
107 |
Q |
| |
|
||||||||| ||||||| || |||||||| || |||||||||||||||||| |
|
|
| T |
29005373 |
tttatcaataacaattacttgtctcataactttttatgtatcaatgacaaa |
29005323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University