View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11750_low_27 (Length: 331)
Name: NF11750_low_27
Description: NF11750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11750_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 42427904 - 42428168
Alignment:
| Q |
17 |
agttggagctgtgtccgcaccatactgtagcagttgtgagttcattgtcaaatttatttactactacgacggttaatctccaagcatcttcacatcacgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42427904 |
agttggagctgtgtccgcaccatactgtagcagttgtgagttcattgtcaaatttatttact-ctacgacggttaatctccaagcatcttcacatcacgg |
42428002 |
T |
 |
| Q |
117 |
ttgttactgtgaatttctttcaatttgaattttctttgtttgtagctgtttaaattgttcttggttgcacgatatacaagtaatacacnnnnnnnactct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
42428003 |
ttgttactgtgaatttctttcaatttgaattttctttgtttgtagctgtctaaattgttcttggttgcacgatatacaagtaattcactttttttactct |
42428102 |
T |
 |
| Q |
217 |
ttgttaccttgaaaaacacatgacaaacaa-tttagatgtggtaaaatttgggacctggatcgtct |
281 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
42428103 |
ttgttgccttgaaaaacacatgacaaacaactttagatgtggtaaaatttgggaccgagatcgtct |
42428168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University