View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11750_low_36 (Length: 243)

Name: NF11750_low_36
Description: NF11750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11750_low_36
NF11750_low_36
[»] chr1 (2 HSPs)
chr1 (1-108)||(12142792-12142899)
chr1 (57-107)||(29005323-29005373)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 12142899 - 12142792
Alignment:
1 aaaacaattcttttatgacaaacttttaagtaacaacattaaatatgtttttctattttatcaatcacaattatttttctcataatttcttatgtatcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12142899 aaaacaattcttttatgacaaacttttaagtaacaacattaaatatgtttttctattttatcaatcacaattatttttctcataatttcttatgtatcaa 12142800  T
101 tgacaaaa 108  Q
    ||||||||    
12142799 tgacaaaa 12142792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 107
Target Start/End: Complemental strand, 29005373 - 29005323
Alignment:
57 tttatcaatcacaattatttttctcataatttcttatgtatcaatgacaaa 107  Q
    ||||||||| ||||||| || |||||||| || ||||||||||||||||||    
29005373 tttatcaataacaattacttgtctcataactttttatgtatcaatgacaaa 29005323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University