View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11751_high_23 (Length: 253)
Name: NF11751_high_23
Description: NF11751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11751_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 8e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 11230344 - 11230490
Alignment:
| Q |
12 |
agcagagacggggaatcactcctaagcaaccaccgttggatataggaatccatacatgaccttgttttgttgaaattatcagaaaaataaatggacaatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11230344 |
agcagagacggggaatcactcctaagcaaccatcgttggatataggaatccatacatgaccttgttttgttgaaattatcagaaaaataaatggataatg |
11230443 |
T |
|
| Q |
112 |
cttttccaacatgcttggttcgaaacttggacttggtgcgtgaataa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11230444 |
cttttccaacatgcttggttcgaaacttggacttggtgcgtgaataa |
11230490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 155 - 253
Target Start/End: Original strand, 11230899 - 11230997
Alignment:
| Q |
155 |
ataacagcaacaatcacacaaacatacattgtatgttggtctaagactaatgtgaaattattggttaatgcaccattacaacaaaccagtgtgatcccg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11230899 |
ataacagcaacaatcacacaaacatacattgtatgttggtctaagactaatgtgaaattattggttaatgcaccattacaacaaaccagtgtgatcccg |
11230997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 155 - 253
Target Start/End: Original strand, 11243086 - 11243184
Alignment:
| Q |
155 |
ataacagcaacaatcacacaaacatacattgtatgttggtctaagactaatgtgaaattattggttaatgcaccattacaacaaaccagtgtgatcccg |
253 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||||||||| | |||| ||||||| |||| |||||||||||| ||||||||||||| |
|
|
| T |
11243086 |
ataacagcaccaatcacacaaagatacattgtatgttggtctgagactaatgcggaatttttggttactgcagcattacaacaaaacagtgtgatcccg |
11243184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University