View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11751_low_30 (Length: 241)
Name: NF11751_low_30
Description: NF11751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11751_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 11 - 98
Target Start/End: Original strand, 34051053 - 34051143
Alignment:
| Q |
11 |
ttttttaatagtgttcaatattgttcctatttttagtgattgtttccta---ttgttgttgattgttcctattataataaaatttaaccag |
98 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34051053 |
ttttttaatagtgtccaatattgttcctattttcagtgattgttttctattgttgttgttgattgttcctattataataaaatttaaccag |
34051143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 224
Target Start/End: Original strand, 34051240 - 34051270
Alignment:
| Q |
194 |
gtgtattcccttatatatttgtatagatata |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34051240 |
gtgtattcccttatatatttgtatagatata |
34051270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 11860664 - 11860698
Alignment:
| Q |
1 |
caaaataatattttttaatagtgttcaatattgtt |
35 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11860664 |
caaaataatgttttttaatagtgttcaatattgtt |
11860698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University