View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11751_low_32 (Length: 227)
Name: NF11751_low_32
Description: NF11751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11751_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 42747098 - 42747308
Alignment:
| Q |
1 |
acgctatccacaccccttctcccacttttcatttccactaacccacaccaccttaatcctcaccatctccaaaacctctgctccatatgcaaccactctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42747098 |
acgctatccacaccccttctcccacttttcatttccactaacccacaccaccttaatcctcaccatctccaaaacctctgctccatatgcaaccactctt |
42747197 |
T |
 |
| Q |
101 |
ttcacagatttcccaactttaatatctctgacaaccctgaacaagttgatatcaacaagcttcgcattgctctttctcatagtgatgttcttgtctctgt |
200 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42747198 |
ttcacagattccccaaccttaatatctctgacacccctgagcaagttgatatcaacaagcttcgcattgctctttctcatagtgatgttcttgtctctgt |
42747297 |
T |
 |
| Q |
201 |
tttctgtaaac |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
42747298 |
tttctgtaaac |
42747308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University