View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11752_low_12 (Length: 220)
Name: NF11752_low_12
Description: NF11752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11752_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 10881287 - 10881109
Alignment:
| Q |
18 |
gaaatagcaaaagtgagagtttggatttctatctagagcttcaacttccgtttccaaatagtattattaattttgactataagtttagtttttctacgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10881287 |
gaaatagcaaaagtgagagtttggatttctatctagagcttcaacttccgtttccaaataatattattaattttgactatatatttagtttttctacgtt |
10881188 |
T |
 |
| Q |
118 |
tcaacatgacaagtttatgtttggttttcgtttagcaaattttcactctcaagaaccgtttcctgtcctagagtgggag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10881187 |
tcaacatgacaagtttatgtttggttttcgtttagcaaattttcactctcaagaaccgtttcctgtcctagagtgggag |
10881109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University