View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11752_low_12 (Length: 220)

Name: NF11752_low_12
Description: NF11752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11752_low_12
NF11752_low_12
[»] chr2 (1 HSPs)
chr2 (18-196)||(10881109-10881287)


Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 10881287 - 10881109
Alignment:
18 gaaatagcaaaagtgagagtttggatttctatctagagcttcaacttccgtttccaaatagtattattaattttgactataagtttagtttttctacgtt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  |||||||||||||||||    
10881287 gaaatagcaaaagtgagagtttggatttctatctagagcttcaacttccgtttccaaataatattattaattttgactatatatttagtttttctacgtt 10881188  T
118 tcaacatgacaagtttatgtttggttttcgtttagcaaattttcactctcaagaaccgtttcctgtcctagagtgggag 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10881187 tcaacatgacaagtttatgtttggttttcgtttagcaaattttcactctcaagaaccgtttcctgtcctagagtgggag 10881109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University