View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11752_low_6 (Length: 418)
Name: NF11752_low_6
Description: NF11752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11752_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 9 - 286
Target Start/End: Complemental strand, 36602398 - 36602121
Alignment:
| Q |
9 |
ggagcacagatgaaaagacagctggctttctatctgagttaggagttattgctcatgttgatcatcctaatactgcaaagcttgttggatgttgtgtaga |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36602398 |
ggagcacagatgaaaagacagctggctttctatctgagttaggagttattgctcatgttgatcatcctaataccgcaaagcttgttggatgttgtgtaga |
36602299 |
T |
|
| Q |
109 |
gggagaaatgcatcttgtcttcgaattgtctacactgggaagtttaggatatgttcttcatggtttgtagatactttgaactctctcatgatgacaatca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602298 |
gggagaaatgcatcttgtcttcgaattgtctacactgggaagtttaggatacgttcttcatggtttgtagatactttgaactctctcatgatgacaatca |
36602199 |
T |
|
| Q |
209 |
cttttgaacttattttgtttttatatcaaatggaatgaaactcaatactcgagggtttacaaccctcgcacacatatt |
286 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602198 |
cttttaaacttattttgttttcatatcaaatggaatcaaactcaatactcgagggtttacaaccctcgcacacatatt |
36602121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 287 - 405
Target Start/End: Complemental strand, 36602086 - 36601968
Alignment:
| Q |
287 |
aacatgctttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt |
386 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602086 |
aacatactttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt |
36601987 |
T |
|
| Q |
387 |
gctcttggaattgctgatg |
405 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
36601986 |
gctctcggaattgctgatg |
36601968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 126
Target Start/End: Original strand, 47014089 - 47014181
Alignment:
| Q |
34 |
ctttctatctgagttaggagttattgctcatgttgatcatcctaatactgcaaagcttgttggatgttgtgtagagggagaaatgcatcttgt |
126 |
Q |
| |
|
||||||||||||| |||| ||||||||||| | | |||||||| ||||| | ||| |||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
47014089 |
ctttctatctgagctaggcattattgctcatctaaaccatcctaacactgccagacttattggatgtggtgtagaaggagaaatgcaccttgt |
47014181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University