View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11752_low_7 (Length: 364)
Name: NF11752_low_7
Description: NF11752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11752_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 9 - 348
Target Start/End: Complemental strand, 28906688 - 28906349
Alignment:
| Q |
9 |
acgttggaggttgattccaggtaatgtatatgctgaatgtgatgcacacgtgtgtcatcaattttgtagttttgttgcggggatttgtttgaatttctta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28906688 |
acgttggaggttgattccaggtaatgtatatgctgaatgtcatgcacatgtgtgtcatcgattttgtagttttgttgcggggatttgtttgaatttctta |
28906589 |
T |
|
| Q |
109 |
attgtgtatccagaaattaaaggttatgtgttgtgttttatgtttatatttcgtgtgtcggaaattatgagaccgtggttgttgtttttcttcatcagag |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28906588 |
attgtgtagccagaaattaaaggttatgtgttgtgttttatgtttatatttcgtgtatcggaaattatgagaccgtggttgttgtttttcttcatcagag |
28906489 |
T |
|
| Q |
209 |
caataatcaatcacatttgcatgtatgtgtacagggattcttatggatttacattaaggcctcaatacgcacaaagatatagagagtattccttaatcta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28906488 |
caataatcaatcacatttgcatgtatgtgtacagggattcttatggatttacattaaggcctcaattcgcacaaagatatagagagtattccttaatcta |
28906389 |
T |
|
| Q |
309 |
caaggtaactatccattttgcttcagtttgggtttatctt |
348 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
28906388 |
caaggtaactatccattgtgcttcagtatgggtttatctt |
28906349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University