View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11753_high_16 (Length: 250)
Name: NF11753_high_16
Description: NF11753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11753_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 39052486 - 39052240
Alignment:
| Q |
8 |
aagaaaaggacaagaaaaacgcgtgagaaagtgtgttgtgttgtaacaacacggcacgaacaccaacagttacagaagaagtgttgaaaaagaagaagta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39052486 |
aagaaaaggacaagaaaaacgcgtgagaaagtgtgttgtgttgtaacaacacggcacgaacaccaacagttacagaagaagtgttgaaaaagaagaagta |
39052387 |
T |
 |
| Q |
108 |
attgtactcagagagagaga----atgaatgaattatgaataaatgtagtagatttactagattggatcgattgatgagtttggtctgatcaactttgtt |
203 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39052386 |
attgtacccagagagagagagagaatgaatgaattatgaataaatgtagtagatttactagattggatcgattgatgagtttggtctgatcaactttgtt |
39052287 |
T |
 |
| Q |
204 |
tatttttaagggctcgaggtacctcaatatgtgtacccttccaacac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39052286 |
tatttttaagggctcgaggtacctcaatatgtgtacccttccaacac |
39052240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University