View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11753_high_19 (Length: 229)
Name: NF11753_high_19
Description: NF11753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11753_high_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 39051989 - 39052213
Alignment:
| Q |
6 |
accttatacctctgctaagttgacgaccaaaccgaattttaaaactatatttatgtgattccccaaacaatattat-gagggcattggaacggagggaag |
104 |
Q |
| |
|
|||||||||| ||||| ||||| || ||||||||||||||||||||||||| ||||||| || ||||||| || | ||||||||||||||||||||||| |
|
|
| T |
39051989 |
accttatacccctgctgtgttgatgatcaaaccgaattttaaaactatatttctgtgatttcctaaacaatgttcttgagggcattggaacggagggaag |
39052088 |
T |
 |
| Q |
105 |
tattgattagataaagagtcttgatctaacatgagattatgagatctaatttcactccatgagagtggatgccacctagcaagtaatcttggttgatagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39052089 |
tattgattagataaagagtcttgatctaacatgagattatgagatctaatttcactccatgagagtggatgccacctagcaagtaatcttggttgatagt |
39052188 |
T |
 |
| Q |
205 |
ggagaagtaataataaatggtgttt |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39052189 |
ggagaagtaataataaatggtgttt |
39052213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University