View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_high_10 (Length: 408)
Name: NF11755_high_10
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 39090164 - 39090330
Alignment:
| Q |
1 |
agggtcaaattgaaaacccttttctcttttacatt-cattctcttttatgttaaatgggtctctcttttttcataattcactgaacaaaaatttcacctt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090164 |
agggtcaaattgaaaacccttttctcttttacgttacattctcttttccgttaaatgggtctctcttttttcataattcactgaacaaaaatttcacctt |
39090263 |
T |
|
| Q |
100 |
ttttgaccccaaaatctcaaaacaggattgaaattccaaattcttcacaacaatggaaggtattgtg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090264 |
ttttgaccccaaaatctcaaaacaggatcggaattccaaattcttcacaacaatggaaggtattgtg |
39090330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 237 - 380
Target Start/End: Original strand, 39090401 - 39090550
Alignment:
| Q |
237 |
catgtattgaaattgaatca------ggttagaatctacgatagggattgtttgcattactgggtagattgttgcaatggtggatttggcataaaggagt |
330 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
39090401 |
catgtattgaaattgaatcaatgttaggttagaatctacactagagattgtttgcattactgggtagattgttgcaatggtggatttgacataaaggatt |
39090500 |
T |
|
| Q |
331 |
taaatttggggtctttgggttatgagaaagtgagtcaaacttaagggtat |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39090501 |
taaatttggggtctttgggttatgagaaagtgagtcaaacttaagggtat |
39090550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University