View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11755_high_12 (Length: 386)

Name: NF11755_high_12
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11755_high_12
NF11755_high_12
[»] chr7 (6 HSPs)
chr7 (117-203)||(32718837-32718923)
chr7 (286-367)||(32718662-32718743)
chr7 (15-75)||(32718968-32719028)
chr7 (286-363)||(32715288-32715365)
chr7 (118-167)||(32715465-32715514)
chr7 (290-367)||(32710062-32710139)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 117 - 203
Target Start/End: Complemental strand, 32718923 - 32718837
Alignment:
117 cttctcaatatacagaactcgatggaacaatagtggcaataaataatgataatgatatatgtctaatacaaggaaatattagatatg 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32718923 cttctcaatatacagaactcgatggaacaatagtggcaataaataatgataatgatatatgtctaatacaaggaaatattagatatg 32718837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 286 - 367
Target Start/End: Complemental strand, 32718743 - 32718662
Alignment:
286 gatgaaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcagtgcaatagttataa 367  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
32718743 gatgaaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcggtgcaatagttataa 32718662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 32719028 - 32718968
Alignment:
15 caacacagacctatgcaaattacaactggtactttagcacttgccattattagcacagccg 75  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
32719028 caacacagacctatgcaaattacaactggttctttagcacttgccattattagcacagccg 32718968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 286 - 363
Target Start/End: Complemental strand, 32715365 - 32715288
Alignment:
286 gatgaaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcagtgcaatagtt 363  Q
    |||||||||||| |||||  |||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||    
32715365 gatgaaaatttaaatgtcctggtctcttttgcattctggtggaacttgaggcaaacgttttctatcagtgcaatagtt 32715288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 32715514 - 32715465
Alignment:
118 ttctcaatatacagaactcgatggaacaatagtggcaataaataatgata 167  Q
    |||||||| |||||||||||||||||||||| ||||||||||||||||||    
32715514 ttctcaatttacagaactcgatggaacaataatggcaataaataatgata 32715465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 367
Target Start/End: Complemental strand, 32710139 - 32710062
Alignment:
290 aaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcagtgcaatagttataa 367  Q
    |||||||| ||||||||||||||| | |||||||| || || ||||| |||||| | |||||||| || || ||||||    
32710139 aaaatttaaatgtcacggtctcttctacattcagggggtatctgagggaaacgtgttctatcagtacagtaattataa 32710062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University