View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_high_33 (Length: 240)
Name: NF11755_high_33
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 82 - 180
Target Start/End: Complemental strand, 29177342 - 29177243
Alignment:
| Q |
82 |
aacacactaagtaatttt-gtattgaactttaaagacaataagtatatataaaataaagacaggtaaatatagaaacaatgttttaaaaaaggaatggag |
180 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29177342 |
aacacactaactaatttttgtattgaactttaaagacaataagtatatataaaataaagacaggtatatatagaaacaatgttttaaaaaaggaatggag |
29177243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 50 - 104
Target Start/End: Complemental strand, 29177410 - 29177356
Alignment:
| Q |
50 |
ttctagcttgcaataaatatggacaatattaaaacacactaagtaattttgtatt |
104 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
29177410 |
ttctagcttgcgataaatatggacaatattgaaacacactaactaattttttatt |
29177356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University