View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_high_37 (Length: 236)
Name: NF11755_high_37
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 35 - 224
Target Start/End: Complemental strand, 5361206 - 5361017
Alignment:
| Q |
35 |
aatgaatttgtaagtatttgtttattattttcatgtataatctgnnnnnnnagtactgtccatttataatctttaaactcttgataagaacggtttttgc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5361206 |
aatgaatttgtaagtatttgtttattattttcatgtataatctgtttttttagtactgtccatttataatctttaaactcttgataagaacggtttttgc |
5361107 |
T |
|
| Q |
135 |
catataaaccaattcgagaaatgtccaataatatgtttttccttatacaatagtattgccttttaaaaaacttttcttatatgatttttg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5361106 |
catataaaccaattcgagaaatgtccaataatatgatttttcttatacaatagtattgccttttaaaaaactttttttatatgatttttg |
5361017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 5361285 - 5361251
Alignment:
| Q |
16 |
atgaaaaaatttacgattcaatgaatttgtaagta |
50 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
5361285 |
atgaaaaagtttacgattcaatgaatttgtaagta |
5361251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University