View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_low_13 (Length: 386)
Name: NF11755_low_13
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 117 - 203
Target Start/End: Complemental strand, 32718923 - 32718837
Alignment:
| Q |
117 |
cttctcaatatacagaactcgatggaacaatagtggcaataaataatgataatgatatatgtctaatacaaggaaatattagatatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32718923 |
cttctcaatatacagaactcgatggaacaatagtggcaataaataatgataatgatatatgtctaatacaaggaaatattagatatg |
32718837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 286 - 367
Target Start/End: Complemental strand, 32718743 - 32718662
Alignment:
| Q |
286 |
gatgaaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcagtgcaatagttataa |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32718743 |
gatgaaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcggtgcaatagttataa |
32718662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 32719028 - 32718968
Alignment:
| Q |
15 |
caacacagacctatgcaaattacaactggtactttagcacttgccattattagcacagccg |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32719028 |
caacacagacctatgcaaattacaactggttctttagcacttgccattattagcacagccg |
32718968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 286 - 363
Target Start/End: Complemental strand, 32715365 - 32715288
Alignment:
| Q |
286 |
gatgaaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcagtgcaatagtt |
363 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
32715365 |
gatgaaaatttaaatgtcctggtctcttttgcattctggtggaacttgaggcaaacgttttctatcagtgcaatagtt |
32715288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 32715514 - 32715465
Alignment:
| Q |
118 |
ttctcaatatacagaactcgatggaacaatagtggcaataaataatgata |
167 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32715514 |
ttctcaatttacagaactcgatggaacaataatggcaataaataatgata |
32715465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 290 - 367
Target Start/End: Complemental strand, 32710139 - 32710062
Alignment:
| Q |
290 |
aaaatttatatgtcacggtctcttttgcattcaggtggaatttgaggcaaacgtttcctatcagtgcaatagttataa |
367 |
Q |
| |
|
|||||||| ||||||||||||||| | |||||||| || || ||||| |||||| | |||||||| || || |||||| |
|
|
| T |
32710139 |
aaaatttaaatgtcacggtctcttctacattcagggggtatctgagggaaacgtgttctatcagtacagtaattataa |
32710062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University