View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_low_16 (Length: 359)
Name: NF11755_low_16
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 156 - 318
Target Start/End: Original strand, 23182863 - 23183038
Alignment:
| Q |
156 |
caggaatgcagtagtttctttgcactcttttcttgtaggaatgtctttcttcccaaacatgtggtacggatcca-------------ttgtttgtaaaac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23182863 |
caggaatgcagtagtttctttgcactcttttcttgtaggaatgtctttcttcccaaacatgtggtacggatccattgtttggagaatttgtttgtaaaac |
23182962 |
T |
|
| Q |
243 |
tagtaattggttgaatggtgaagtgaagaaagaatcaatagttaggatttatgaaaggtagttattagaattgtga |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
23182963 |
tagtaattggttgaatggtgaagtgaagaaagaatcaatagttaggatttatgaaaggtagttgttagagttgtga |
23183038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 23182718 - 23182761
Alignment:
| Q |
11 |
tgagatgaatcttctgattcagcatttgaaaatatttttcaaac |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23182718 |
tgagatgaatcttctgattcagcatttgaaaatatttttcaaac |
23182761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University