View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_low_18 (Length: 340)
Name: NF11755_low_18
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 18 - 330
Target Start/End: Complemental strand, 26305011 - 26304699
Alignment:
| Q |
18 |
acttctgggtattgttgctggtctgaaaagaagcatgcagtgagggacaaataaattgcacataccaagccaaagttgaaattctttacacacacctagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305011 |
acttctgggtattgttgctggtctgacaagaagcatgcagtgagggacaaataaattgcacataccaagccaaagttgaaattctttacacacacctagc |
26304912 |
T |
 |
| Q |
118 |
tatgtggctgtttaactccaatcaccataatacaaattttggccgcattgagtcaacataacttgacttgaatggaactaaccgcttgccacaatctcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26304911 |
tatgtggctgtttaactccaatcaccataatacaaattttggccgcattgagtaaacataacttgacttgaatggaactaaccgcttgccacaatctcat |
26304812 |
T |
 |
| Q |
218 |
ggatggcatcactgacagttacatcatcagatctgacagccagtttcattgcaacatcctttgcaccatcaagtccaaaagacagccgcacaagtacctt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26304811 |
ggatggcatcactgacagttacatcatcagatctgacagccagtttcattgcaacatcctttgcaccatcaagtccaaaagacagccgcacaagtacctt |
26304712 |
T |
 |
| Q |
318 |
cacaccccctatg |
330 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26304711 |
cacaccccctatg |
26304699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 7e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 199 - 317
Target Start/End: Complemental strand, 54491749 - 54491631
Alignment:
| Q |
199 |
ccgcttgccacaatctcatggatggcatcactgacagttacatcatcagatctgacagccagtttcattgcaacatcctttgcaccatcaagtccaaaag |
298 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |||| || |||||||||| || |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54491749 |
ccgctagccacaatctcatgaatggcatcactgacagtttcatcctcggatctgacagtcaatttcattgcaacatcctttggaccatcaagtccaaaag |
54491650 |
T |
 |
| Q |
299 |
acagccgcacaagtacctt |
317 |
Q |
| |
|
||| ||||||||| ||||| |
|
|
| T |
54491649 |
acaaccgcacaagcacctt |
54491631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University