View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_low_24 (Length: 292)
Name: NF11755_low_24
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 135 - 277
Target Start/End: Complemental strand, 12666359 - 12666217
Alignment:
| Q |
135 |
tgaaggaaattgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12666359 |
tgaaggaaattgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtg |
12666260 |
T |
|
| Q |
235 |
gtggtggttatgaagatttatgtgatattgttgtttgtgatgt |
277 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
12666259 |
gtggtggtgatgaagatttatgtgatattgttgttggtgatgt |
12666217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 135 - 277
Target Start/End: Original strand, 667954 - 668096
Alignment:
| Q |
135 |
tgaaggaaattgattttgaattggaattggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
667954 |
tgaaggaaattgattttgaattggaattggaattagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttgatagtg |
668053 |
T |
|
| Q |
235 |
gtggtggttatgaagatttatgtgatattgttgtttgtgatgt |
277 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
668054 |
gtggtggtgatgaagatttatgtgatattgttgttggtgatgt |
668096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 162 - 241
Target Start/End: Complemental strand, 21913970 - 21913891
Alignment:
| Q |
162 |
tggatttagggttagggtatggagtggaggtgcgtggtgtaacgaagctacagtgcggttggtgttggtagtggtggtgg |
241 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||||||||||| |||| || || ||| || ||||||||| |||||||||| |
|
|
| T |
21913970 |
tggagttagggttagggtttggagtggtggtgcgtggtggaacggagagacggtgggggcggtgttggtggtggtggtgg |
21913891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University