View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11755_low_25 (Length: 274)

Name: NF11755_low_25
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11755_low_25
NF11755_low_25
[»] chr1 (2 HSPs)
chr1 (19-161)||(48287851-48287993)
chr1 (196-253)||(48287765-48287822)
[»] chr4 (2 HSPs)
chr4 (19-161)||(37559510-37559652)
chr4 (196-232)||(37559675-37559711)
[»] chr3 (2 HSPs)
chr3 (19-161)||(41386894-41387036)
chr3 (196-232)||(41386835-41386871)
[»] chr7 (1 HSPs)
chr7 (23-89)||(48671911-48671977)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 48287993 - 48287851
Alignment:
19 gatctgcatctttttcatactcatacacttcagattcttttgttttgtagctatgaagttaacaatgtgaggtaaagttttcacctttttgcaatggtgg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
48287993 gatctgcatctttttcatactcatacacttcagattcttttgttttgtagctatgaaggtaacaatgtgaggtaaagttttcacctttttgcaatggtgg 48287894  T
119 ctgccatttctgaaaacccattaacctcttcaaggtccgacat 161  Q
    |||||||||||||||||||||||||||||||||||||||||||    
48287893 ctgccatttctgaaaacccattaacctcttcaaggtccgacat 48287851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 196 - 253
Target Start/End: Complemental strand, 48287822 - 48287765
Alignment:
196 ggtgtcttacccagaagaaaaggtagacaaatttcttctaggtacatgtctccttcac 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48287822 ggtgtcttacccagaagaaaaggtagacaaatttcttctaggtacatgtctccttcac 48287765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 37559510 - 37559652
Alignment:
19 gatctgcatctttttcatactcatacacttcagattcttttgttttgtagctatgaagttaacaatgtgaggtaaagttttcacctttttgcaatggtgg 118  Q
    |||||||||| |||||||||||||||||||   ||| | | |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||    
37559510 gatctgcatcattttcatactcatacactttgaattatgtagttttgaagctatgaaggtaacaatgtgaggtaaagttttcacctttttgcaatggtgg 37559609  T
119 ctgccatttctgaaaacccattaacctcttcaaggtccgacat 161  Q
    ||||||||||||||||| |||||||||||||||| ||||||||    
37559610 ctgccatttctgaaaacacattaacctcttcaagatccgacat 37559652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 232
Target Start/End: Original strand, 37559675 - 37559711
Alignment:
196 ggtgtcttacccagaagaaaaggtagacaaatttctt 232  Q
    ||||| |||||||| ||||||||||||||||||||||    
37559675 ggtgtgttacccaggagaaaaggtagacaaatttctt 37559711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 41387036 - 41386894
Alignment:
19 gatctgcatctttttcatactcatacacttcagattcttttgttttgtagctatgaagttaacaatgtgaggtaaagttttcacctttttgcaatggtgg 118  Q
    |||||||||| |||||||||||||||||||   ||| | | |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||    
41387036 gatctgcatcattttcatactcatacactttgaattatgtagttttgaagctatgaaggtaacaatgtgaggtaaagttttcacctttttgcaatggtgg 41386937  T
119 ctgccatttctgaaaacccattaacctcttcaaggtccgacat 161  Q
    ||||||||||||||||| |||||||||||||||| ||||||||    
41386936 ctgccatttctgaaaacacattaacctcttcaagatccgacat 41386894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 196 - 232
Target Start/End: Complemental strand, 41386871 - 41386835
Alignment:
196 ggtgtcttacccagaagaaaaggtagacaaatttctt 232  Q
    ||||| |||||||| ||||||||||||||||||||||    
41386871 ggtgtgttacccaggagaaaaggtagacaaatttctt 41386835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 89
Target Start/End: Complemental strand, 48671977 - 48671911
Alignment:
23 tgcatctttttcatactcatacacttcagattcttttgttttgtagctatgaagttaacaatgtgag 89  Q
    |||||| |||||||||||||||||||| |||||| |  ||||| |||||||||| ||| ||||||||    
48671977 tgcatcattttcatactcatacacttcggattctgtaattttgaagctatgaaggtaataatgtgag 48671911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University