View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_low_30 (Length: 251)
Name: NF11755_low_30
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 14789992 - 14790238
Alignment:
| Q |
1 |
tttgataatggtttttgatgctatagcatatgcatgtaatgaatgtggagatgctgtgtatatatataaatataatgcaccatgtgcaatggtgcgtaaa |
100 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14789992 |
tttgataatggttttggatgcaatggcatatgcatgtaatgaatgtggagatgctgtggatatatataaatataatgcaccatgtgcaatggtgcataaa |
14790091 |
T |
 |
| Q |
101 |
aataacgggtctgatgctgttaatgtttaaggaagtcttcttagtctcaattgttggatttgtttatatcacacaagataaaaggttgataatcagaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14790092 |
aataacgggtctgatgctgttaatgtttaaggaagtcttcttagtctcaattgttggatttgtttatatcacacaagataaaaggttgataatcagaatc |
14790191 |
T |
 |
| Q |
201 |
ctgttttaaaaagtgtttttcactagtcaactcaatctgtgctgctc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14790192 |
ctgttttaaaaagtgtttttcactagtcaactcaatttgtgctgctc |
14790238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 14875307 - 14875361
Alignment:
| Q |
123 |
atgtttaaggaagtcttcttagtctcaattgttggatttgtttatatcacacaagata |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14875307 |
atgtttaaggaagtctt---agtctcaattgttggatttgtttatatcacacaagata |
14875361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University