View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11755_low_35 (Length: 240)

Name: NF11755_low_35
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11755_low_35
NF11755_low_35
[»] chr3 (2 HSPs)
chr3 (82-180)||(29177243-29177342)
chr3 (50-104)||(29177356-29177410)


Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 82 - 180
Target Start/End: Complemental strand, 29177342 - 29177243
Alignment:
82 aacacactaagtaatttt-gtattgaactttaaagacaataagtatatataaaataaagacaggtaaatatagaaacaatgttttaaaaaaggaatggag 180  Q
    |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
29177342 aacacactaactaatttttgtattgaactttaaagacaataagtatatataaaataaagacaggtatatatagaaacaatgttttaaaaaaggaatggag 29177243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 50 - 104
Target Start/End: Complemental strand, 29177410 - 29177356
Alignment:
50 ttctagcttgcaataaatatggacaatattaaaacacactaagtaattttgtatt 104  Q
    ||||||||||| |||||||||||||||||| ||||||||||| ||||||| ||||    
29177410 ttctagcttgcgataaatatggacaatattgaaacacactaactaattttttatt 29177356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University