View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11755_low_40 (Length: 235)
Name: NF11755_low_40
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11755_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 36331354 - 36331558
Alignment:
| Q |
19 |
gcattaaccctggcagtcgataatagtaataatttgnnnnnnntgaattaatttatatagttaatatacacactttcatctgaaatctcgatgagtaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331354 |
gcattaaccctggcagtcgataatagtaataatttgaaaaaa-tgaattaatttatatagttaatatacacactttcatctgaaatctcgatgagtaaaa |
36331452 |
T |
 |
| Q |
119 |
acacttaagtttgatatttggacaacgagtaaaaacacttaagttttatcagcaaaaacgcgtaaaattaatcatgctaacatcataaaattgttgcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
36331453 |
acacttaagtttgatatttggacaacgagtaaaaacacttaagttttatcagcaaaaacgcgtaaaattactcatgctaacatcgtaaaattgttgcaca |
36331552 |
T |
 |
| Q |
219 |
ggttct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
36331553 |
ggttct |
36331558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University