View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11755_low_40 (Length: 235)

Name: NF11755_low_40
Description: NF11755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11755_low_40
NF11755_low_40
[»] chr8 (1 HSPs)
chr8 (19-224)||(36331354-36331558)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 36331354 - 36331558
Alignment:
19 gcattaaccctggcagtcgataatagtaataatttgnnnnnnntgaattaatttatatagttaatatacacactttcatctgaaatctcgatgagtaaaa 118  Q
    ||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36331354 gcattaaccctggcagtcgataatagtaataatttgaaaaaa-tgaattaatttatatagttaatatacacactttcatctgaaatctcgatgagtaaaa 36331452  T
119 acacttaagtttgatatttggacaacgagtaaaaacacttaagttttatcagcaaaaacgcgtaaaattaatcatgctaacatcataaaattgttgcaca 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
36331453 acacttaagtttgatatttggacaacgagtaaaaacacttaagttttatcagcaaaaacgcgtaaaattactcatgctaacatcgtaaaattgttgcaca 36331552  T
219 ggttct 224  Q
    ||||||    
36331553 ggttct 36331558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University