View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11756_low_12 (Length: 287)
Name: NF11756_low_12
Description: NF11756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11756_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 24 - 234
Target Start/End: Complemental strand, 40564901 - 40564682
Alignment:
| Q |
24 |
agttgtttcagacaaagatgaacgaaatcacaagttattgaatttggtagcagttgtgtatgatgttagaatgttagaacagtgggtcccacactagttt |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40564901 |
agttgtttcagacaaagatgaacaaaatcgcaagttattgaatttggtagcagttgtgtatgatgttagaatgttagaacagtgggtcccgcactagttt |
40564802 |
T |
 |
| Q |
124 |
aaggatttggtagatacaacacaaaacttcctgtctttctttcctttgacagagtgtc---------nnnnnnnnncaatgttgttaggatttttcttct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40564801 |
aaggatttggtagatacaacacaaaacttcctgtctttctttcctttgacagagtgtcttgttttttttttcttttcaatgttgttaggatttttcttct |
40564702 |
T |
 |
| Q |
215 |
tcttttctttagataataat |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40564701 |
tcttttctttagataataat |
40564682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University