View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11757_high_15 (Length: 270)
Name: NF11757_high_15
Description: NF11757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11757_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 43224962 - 43224731
Alignment:
| Q |
16 |
gtatgtttggattttcatggcctttggaattgttccatgctatagtgcagattttttctctcatactgtgctctcnnnnnnnnnncttctcgctctttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
43224962 |
gtatgtttggattttcatggcctttggaattgttccatgcta--gtgcagattttttctctcttactgtgctctttttttt-----ttctcgctctttat |
43224870 |
T |
 |
| Q |
116 |
cctattatacaactctttcttatatctcgtctctagtaataatgttttgctttgaaattgattaatatagtcaatattatctgaaaagaacagcggagaa |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224869 |
cctgttatacaactctttcttatatctcgtctctagtaataatgttttgctttgaaattgattaatatagtcaatattatctgaaaagaacagcggagaa |
43224770 |
T |
 |
| Q |
216 |
caacatgaaatcatgattgcaagaactagccgagacaaa |
254 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
43224769 |
caacatgaaatcatgactgcaagaactagccgaaacaaa |
43224731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University