View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11757_high_17 (Length: 241)
Name: NF11757_high_17
Description: NF11757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11757_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 3584353 - 3584576
Alignment:
| Q |
1 |
cctaaaagatgttgcgcnnnnnnnntcaatgaaattataatacattgtaaaggcgttagatactttttagaaatagaaacccactattaacttatacctg |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3584353 |
cctaaaagatgttgcgcaaaaaaaatcaatgaaattataatacattgtaaaggcgtcagatactttttagaaatagaaacccactattaacttatacctg |
3584452 |
T |
 |
| Q |
101 |
taaaatttgctttgaatgcaacagctttctccatgtatgcaccattgaaagtagaaccgctaaaatctgattctctcatatcagcagatgtgaaattggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3584453 |
taaaatttgctttgaatgcaacagctttctccatgtatgcaccattgaaagtagaaccgctaaaatctgattctctcatatcagcagatgtgaaattggc |
3584552 |
T |
 |
| Q |
201 |
tcttctgtataagtaatttagatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3584553 |
tcttctgtataagtaatttagatt |
3584576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University