View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11757_high_18 (Length: 240)
Name: NF11757_high_18
Description: NF11757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11757_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 59 - 225
Target Start/End: Complemental strand, 2063702 - 2063536
Alignment:
| Q |
59 |
catccaatacatttataagtaacttttcattttttagattagttaaataatagatgtatctgaatggataaatcaataataatgtaatgctagtaccaca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||| |||| | |||||||||||||||||| |
|
|
| T |
2063702 |
catccaatacatttataagtaacttttcattttttaaattagttaaataatcgatgtatctgaacggataaattaatatttgtgtaatgctagtaccaca |
2063603 |
T |
|
| Q |
159 |
taatatttgtgtaatgccaccaaatgagtttttgttcgtttaactcaaaatgttactgctactaact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
2063602 |
taatatttgtgtaatgccaccaaatgagtttttgtttgttaaactcaaaatgttattgctactaact |
2063536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 122
Target Start/End: Original strand, 6167891 - 6167944
Alignment:
| Q |
69 |
atttataagtaacttttcattttttagattagttaaataatagatgtatctgaa |
122 |
Q |
| |
|
|||||||||||| |||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
6167891 |
atttataagtaattttttcttttttagattaattaaataagagatgtatctgaa |
6167944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 123
Target Start/End: Complemental strand, 24265604 - 24265550
Alignment:
| Q |
69 |
atttataagtaacttttcattttttagattagttaaataatagatgtatctgaat |
123 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
24265604 |
atttataagcaactttttcttttttagatttattaaataattgatgtatctgaat |
24265550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University