View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11757_low_12 (Length: 303)
Name: NF11757_low_12
Description: NF11757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11757_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 282
Target Start/End: Original strand, 3583725 - 3583997
Alignment:
| Q |
10 |
gcaaaggcctgatgcttcatcacagaaaccatcccggtctagtagtttctgtggtggagcactcaacaatggagatgatggggtgccataagcatttcgt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3583725 |
gcaaaggcctgatgcttcatcacagaaaccatcccggtctagtagtttctgtggtggagcactcaacaatggagatgatggggtgccataagcatttcgt |
3583824 |
T |
|
| Q |
110 |
cgtttgtttccgcaacctaaactcactcttgtgcttactcctgttacaggatttgtgccactagcatacttgcataaagcctacataatcagtcaaataa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3583825 |
cgtttgtttccgcaacctaaactcactcttgtgcttactcctgttacaggatttgtgccactagcatacttgcataaagcctacataatcagtcaaataa |
3583924 |
T |
|
| Q |
210 |
tatatgtaattctcagtcataagctcaataaattctacgccaagacagcattttgaccacattgaaacacatt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3583925 |
tatatgtaattctcagtcataagctcaataaattctacgccaagaaagcattttgaccacattgaaacacatt |
3583997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University