View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11757_low_13 (Length: 286)
Name: NF11757_low_13
Description: NF11757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11757_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 43755355 - 43755087
Alignment:
| Q |
1 |
taagaagttaagaaagtttgattatgtaagttgaataattgtttttggcataggaatgaaatgaatcattgaaaagagtgaaagaaagaagaaccttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755355 |
taagaagttaagaaagtttgattatgtaagttgaataattgtttttggcataggaattaaatgaatcattgaaaagagtgaaagaaagaagaaccttttg |
43755256 |
T |
 |
| Q |
101 |
ggagtcattgggttgactttggaactgaaggttgcagctccgaactacgaatttggttcgaagggaaattgttgaagaaagacgaggaagagtggtggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755255 |
ggagtcattgggttgactttggaactgaaggttgcagctccgaactacgaatttggttcgaagggaaattgttgaagaaagacgaggaagagtggtggtt |
43755156 |
T |
 |
| Q |
201 |
ggtttgacacgaaacaacgccattcagttcaatgtctcctcctctcaccttctgttttcttccaactct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755155 |
ggtttgacacgaaacaacgccattcagttcaatgtctcctcctctcaccttctgttttcttccaactct |
43755087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 73 - 198
Target Start/End: Complemental strand, 43759953 - 43759825
Alignment:
| Q |
73 |
aaagagtgaaagaaagaagaaccttttgggagtcattgggttgactttggaactgaaggttgca---gctccgaactacgaatttggttcgaagggaaat |
169 |
Q |
| |
|
|||||||||||||| || ||||||| | ||||||||||| || |||||| |||||||| | ||| ||||| || |||||||||| |||||||| |
|
|
| T |
43759953 |
aaagagtgaaagaaggaggaaccttgcgtgagtcattgggctgcatttggagttgaaggttagaagagcttcgaaccacaaatttggttccaagggaaag |
43759854 |
T |
 |
| Q |
170 |
tgttgaagaaagacgaggaagagtggtgg |
198 |
Q |
| |
|
|| ||||| ||| |||||||||||||||| |
|
|
| T |
43759853 |
tgatgaagcaaggcgaggaagagtggtgg |
43759825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University