View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11757_low_22 (Length: 215)
Name: NF11757_low_22
Description: NF11757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11757_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 170
Target Start/End: Complemental strand, 29138321 - 29138165
Alignment:
| Q |
14 |
agagagatagacatggatgttgaatacgtgatcttctctgtctcaactcaaaatgacacattagaatctatggtgtaagaaaatgtcacatgctagtgca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29138321 |
agagagatagacatggatgttgaatacgtgatcttctctgtctcaactcaaaatgacacgttagaatctatggtgtaagaaaatgtcacatgctagtgca |
29138222 |
T |
 |
| Q |
114 |
gccggtaaacttaacatcccggattaatgtatgagtaaatgaataagaaccaatagg |
170 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29138221 |
gccggtaaaattaacatcccggattaatgtatgagtaaatgaataagaacctatagg |
29138165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University