View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_high_29 (Length: 368)
Name: NF11758_high_29
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 356
Target Start/End: Complemental strand, 10596197 - 10595860
Alignment:
| Q |
19 |
cacccttcacattaaagggcaaccatccactccacattcttggctcaacttttggctgcacatcagcatttggccttttatcatgtaacattttatcctg |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10596197 |
cacccttcacatcaaagggcaaccatccactccacattcttggctcaacttttggctgcacatcagcatttggccttttatcatgtaacaatttatcctg |
10596098 |
T |
 |
| Q |
119 |
ctcatccaccttaaaattttccggttgtttgttaccataatactctggtggaatccaagccaaagggtatggaaaattcctaaactgaattggaaccata |
218 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10596097 |
ctcatccaccttaaaactttccggttgtttgttaccataatactctggttgaatccaagccaaagggtatggaaaattcctaaactgaattggaaccata |
10595998 |
T |
 |
| Q |
219 |
gcatcattctctttcttaccaacatcaggtttttgctcttccaccttcacagatttgtcttccctttggctgcatgaatgattagaacagccacaacaat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595997 |
gcatcattctctttcttaccaacatcaggtttttgctcttccaccttcacagatttgtcttccttttggctgcatgaatgattagaacagccacaacaat |
10595898 |
T |
 |
| Q |
319 |
gatgttcccttggcatatatttatcatactcgtatctc |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595897 |
gatgttcccttggcatatatttatcatactcgtatctc |
10595860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University