View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_high_38 (Length: 246)
Name: NF11758_high_38
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_high_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 13726484 - 13726690
Alignment:
| Q |
1 |
ggtgcatgttttttgcttttattctccattgatttttgtggtgtctcttttcttctggaatgtgtttatatatgaagaagggtgtaaaagtaatagacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13726484 |
ggtgcatgttttttgcttttattctccattgatttttgtggtgtctcttttcttctggaatgtgtttatatatgaagaagggtgtaaaagtaatagacat |
13726583 |
T |
|
| Q |
101 |
aatgatattctaatcaatgaatccattgaacaaaaaagattgcaaagcatcaattgattgtgacctttccatgtaggatttagaccttttcctaatgtgg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13726584 |
aatgatattctaatcaatgaatgcattgaacaaaaaagatagcaaagcatcaagtgattgtgacctttccatgtaggattttgaccttttcctaatgtgg |
13726683 |
T |
|
| Q |
201 |
tgtggca |
207 |
Q |
| |
|
||||||| |
|
|
| T |
13726684 |
tgtggca |
13726690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University