View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11758_high_46 (Length: 227)

Name: NF11758_high_46
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11758_high_46
NF11758_high_46
[»] chr5 (1 HSPs)
chr5 (14-212)||(40123092-40123290)
[»] chr3 (1 HSPs)
chr3 (31-171)||(18174336-18174476)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 212
Target Start/End: Complemental strand, 40123290 - 40123092
Alignment:
14 cagagaaataatttaaagaaaggaaattacctgttgaggtctcataatctttgtatcaggatcatccaacgactctctccaatgtgacaagtacccggcc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40123290 cagagaaataatttaaagaaaggaaattacctgttgaggtctcataatctttgtatcaggatcatccaacgactctctccaatgtgacaagtacccggcc 40123191  T
114 attcgagggatagcaaataaaactgtgaaatattcgggtggaaaacccatggccctgattgcataaatttattacttaaagcattgtatgatatacttg 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40123190 attcgagggatagcaaataaaactgtgaaatattcgggtggaaaacccatggccctgattgcataaatttattacttaaagcattgtatgatatacttg 40123092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 31 - 171
Target Start/End: Complemental strand, 18174476 - 18174336
Alignment:
31 gaaaggaaattacctgttgaggtctcataatctttgtatcaggatcatccaacgactctctccaatgtgacaagtacccggccattcgagggatagcaaa 130  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| | |||||||| |||||| || ||||| ||||||||||||||    
18174476 gaaaggaaataacctgttgaggtctcataatctttgtatccggatcatccaaggactcccgccaatgtgccaagtatccagccatacgagggatagcaaa 18174377  T
131 taaaactgtgaaatattcgggtggaaaacccatggccctga 171  Q
    |||||  |||||| ||||||||||||| ||||| |||||||    
18174376 taaaatagtgaaaaattcgggtggaaatcccatagccctga 18174336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University