View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_high_46 (Length: 227)
Name: NF11758_high_46
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 212
Target Start/End: Complemental strand, 40123290 - 40123092
Alignment:
| Q |
14 |
cagagaaataatttaaagaaaggaaattacctgttgaggtctcataatctttgtatcaggatcatccaacgactctctccaatgtgacaagtacccggcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40123290 |
cagagaaataatttaaagaaaggaaattacctgttgaggtctcataatctttgtatcaggatcatccaacgactctctccaatgtgacaagtacccggcc |
40123191 |
T |
 |
| Q |
114 |
attcgagggatagcaaataaaactgtgaaatattcgggtggaaaacccatggccctgattgcataaatttattacttaaagcattgtatgatatacttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40123190 |
attcgagggatagcaaataaaactgtgaaatattcgggtggaaaacccatggccctgattgcataaatttattacttaaagcattgtatgatatacttg |
40123092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 31 - 171
Target Start/End: Complemental strand, 18174476 - 18174336
Alignment:
| Q |
31 |
gaaaggaaattacctgttgaggtctcataatctttgtatcaggatcatccaacgactctctccaatgtgacaagtacccggccattcgagggatagcaaa |
130 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| | |||||||| |||||| || ||||| |||||||||||||| |
|
|
| T |
18174476 |
gaaaggaaataacctgttgaggtctcataatctttgtatccggatcatccaaggactcccgccaatgtgccaagtatccagccatacgagggatagcaaa |
18174377 |
T |
 |
| Q |
131 |
taaaactgtgaaatattcgggtggaaaacccatggccctga |
171 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
18174376 |
taaaatagtgaaaaattcgggtggaaatcccatagccctga |
18174336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University