View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_34 (Length: 333)
Name: NF11758_low_34
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 12175485 - 12175297
Alignment:
| Q |
11 |
ataagaatatattatcagtgttatgtttggattgtaataataacttgcttgatattcatgtttgttttaagattattttttacctgcttttctaaattaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12175485 |
ataagaatatattatcagtgttatgtttggattgtaataataacttgcttgatattcatgtttgttttaagattattttttacctgcttttctaaattaa |
12175386 |
T |
 |
| Q |
111 |
ttagttactaacatcatgtagttagtttttgtc-nnnnnnnnnttcatgtaattaatggtgttatttatagttaattcggagaggttaa |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| ||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
12175385 |
ttagttactaacatcatgtagtaagtttttgtcaaaaaaaaaaatcatataaataatggtgttatttctagttaattaggagaggttaa |
12175297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 205 - 240
Target Start/End: Original strand, 28914994 - 28915029
Alignment:
| Q |
205 |
atctatgaagcaccgatacgcctagatagccaccga |
240 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28914994 |
atctatgaagcaccgatacgcctaaatagccaccga |
28915029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University