View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_36 (Length: 276)
Name: NF11758_low_36
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 76 - 255
Target Start/End: Complemental strand, 33926508 - 33926329
Alignment:
| Q |
76 |
accttaccgtacactcaactacacttaatcaaacccccaccctattttttatagctgcaacttccaaattctaacaaaacgcgtttcccagataacgcgt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33926508 |
accttaccgtacactcaactacacttaatcaaacccccaccctattctttatagctgcaacttccaaattctaacaaaacgcgtttcccagataacgcgt |
33926409 |
T |
 |
| Q |
176 |
gaaacttaaacggcgctatataaatcactttccactcttctaggagaaaaataattctcaaaaatccaaaccctaacaca |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33926408 |
gaaacttaaacggcgctatataaatcactttccactcttctaggagaaaaataattctcaaaaatccaaaccctatcaca |
33926329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 33926560 - 33926638
Alignment:
| Q |
1 |
ggaactaggactcgtgtcttagtcgcaactgcatgtaatgaagtgtgccaaaagtttgttatacaggactcttgaacct |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33926560 |
ggaactaggactcgtgtcttagtcgcaactgcatgtaatgaagtgtgccaaaagtttgttatacaggattcttgaacct |
33926638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University