View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_38 (Length: 271)
Name: NF11758_low_38
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 30590476 - 30590217
Alignment:
| Q |
1 |
ccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgggtatttgtctggggagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590476 |
ccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgggtatttgtctggggagaa |
30590377 |
T |
 |
| Q |
101 |
aggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctgaatgtcagattgcttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590376 |
aggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctgaatgtcagattgcttgat |
30590277 |
T |
 |
| Q |
201 |
cagttcccnnnnnnntcccagtgaaagtgctgctgtagactgcaatagcaatgatgtccat |
261 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590276 |
cagttcccaaaaaaa-cccagtgaaagtgctgctgtagactgcaatagcaatgatgtccat |
30590217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University