View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_39 (Length: 270)
Name: NF11758_low_39
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 47375450 - 47375214
Alignment:
| Q |
17 |
tcattgagaccttacaaaatgatgaggatccaaagatgagaagaatctagtttagttgggccttatgttatgaatatttaggaccttgggttagttcaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47375450 |
tcattgagaccttacaaaatgatgag-atccaaagatgagaagaatctagtttagttgggccttatgtaatgaatatttaggaccttgggttagttcaaa |
47375352 |
T |
 |
| Q |
117 |
acaattgcccccaagtcgtcaatccgtagccaggagtgatgaatttgtatgacgttatacaagaagagtgtgttgagcttaatggacaataatgttttat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47375351 |
acaattgcccccaagtcgtcaatccgtagccaggagtgatgaatttgtatgaccttatacaagaagagtgtgttgagcttaatggacaataatgttttat |
47375252 |
T |
 |
| Q |
217 |
tggtaatacgaagaagattctttcaagaagggtctctg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47375251 |
cggtaatacgaagaagattctttcaagaagggtctctg |
47375214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University