View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11758_low_40 (Length: 253)
Name: NF11758_low_40
Description: NF11758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11758_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 43243956 - 43243834
Alignment:
| Q |
1 |
cctgccctgttcttggatgctgattgtgaagaacaagtctcgatctcagccattggggtttcaatgaatagaagaagcatccatgaaatttgaaattttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43243956 |
cctgccctgttcttggatgctgattgtgaagaacaagtctcgatctcagccattggggtttcaatgaagagaagaagcatccatgaaatttgaaattttg |
43243857 |
T |
 |
| Q |
101 |
aagcgcccagcgttataaagatg |
123 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
43243856 |
aagcgccgagcgttataaagatg |
43243834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 158 - 238
Target Start/End: Complemental strand, 43243799 - 43243719
Alignment:
| Q |
158 |
gaagaagaacgcgacacaaagagagtgttagtgttggttttgtgaagcgttgtgatgtgtttgtgttagatcgcgtcaatc |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43243799 |
gaagaagaacgcgacacaaagagtgtgtttgtgttggttttgtgaagcgttgtgatgtgtttgtgttagattgcgtcaatc |
43243719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University